[ Program Manual | User's Guide | Data Files | Databases ]
Fingerprint identifies the products of T1 ribonuclease digestion.
Fingerprint cuts any subrange of a nucleotide sequence at Gs (as if it were digested with T1 ribonuclease) and arranges the fragments in order of their U (or T) content. Within families of U (or T) content, the fragments are arranged by A content and then by C content. Fingerprint shows how the fragments would be labeled if the original molecule had been labeled with any single alpha-(32)P-triphosphate by creating a table of the labeled nucleotides that would be found from an alkaline hydrolysis of each fragment. The labels, after hydrolysis, remain on the 3' side of the nearest neighbor 5' to every nucleotide of the kind labeled.
To identify the fragments of a fingerprint of zein.seq, do the following:
% fingerprint
FINGERPRINT of what sequence ? zein.seq
Begin (* 1 *) ? 14
End (* 614 *) ? 250
Reverse (* No *) ?
Would you like identical fragments summed (* Yes *) ?
What should I call the output file (* zein.fing *) ?
%
Fingerprint leaves an extra blank line between "families" of U content. Here is some of the output file for the example above:
FINGERPRINT of: zein.seq check: 9712 from: 14 to: 250
Corn Storage Protein 19.1 cDNA
Pedersen Devereux and Larkins at Purdue. It was sequenced by
Pedersen and Devereux at Smithies' lab at the University of Wisconsin
and at Larkin's lab at Purdue University, Spring 1981.
Checked carefully September 17, 1981.
September 26, 1996 15:36 ..
Labelling with
Seq Pos GTP | ATP | UTP | CTP
CUUCCCUUCUUCCCCCAUACCUCUCACCAG
26 a | u 3c | a 3u 5c | g 2a 5u 8c
AAAAUCCAAUUCUUCUACCCUACAG
32 g a | 4a 2u 2c | 2a 2u 3c | 2a 3u 3c
CCAAAAUAUUUUG 10 u | 3a u c | 2a 3u | g c
UCUUUCUG 14 u | | 2u 2c | g 2u
CCUCAUUAUG 11 u | u c | 2a u c | g u c
CAUUUUCCCG 22 c | c | a 3u | g u 2c
UACCAAUAAUG 7 g u | 2a 2u c | 2a | a c
CACAAUAUUG 6 u | a u 2c | g 2a u | a
///////////////////////////////////////////////////////////////////////////////
CG 20 | | |
CG 27 | | |
Total: 2c | 2g | |
G 8 | | |
G 13 | | |
G 19 | | |
G 33 | | |
G 35 | | |
G 39 | | |
Total: | g | g | 4g
In the output file, the positions (Pos) indicate the order of T1 ribonuclease fragments in the input sequence. The 5'-terminal fragment is 1 and, in this example, the fragment at the 3' end of the sequence range is 39.
Fingerprint accepts a single nucleotide sequence as input. If Fingerprint rejects your nucleotide sequence, turn to Appendix VI to see how to change or set the type of a sequence.
All parameters for this program may be put on the command line. Use the parameter -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
Minimal Syntax: % fingerprint [-INfile1=]zein.seq -Default Prompted Parameters: -BEGin=14 -END=250 range of interest -NOREVerse strand [-OUTfile1=]zein.fing output file name Optional Parameters: -NOSUMidentical suppresses summing statistics for identical fragments
None.
The parameters listed below can be set from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
suppresses summing the statistics for identical fragments.
[ Program Manual | User's Guide | Data Files | Databases ]
Documentation Comments: doc-comments@gcg.com
Technical Support: help@gcg.com
Copyright (c) 1982, 1983, 1985, 1986, 1987, 1989, 1991, 1994, 1995, 1996, 1997 Genetics Computer Group, Inc. a wholly owned subsidiary of Oxford Molecular Group, Inc. All rights reserved.
Licenses and Trademarks Wisconsin Package is a trademark of Genetics Computer Group, Inc. GCG and the GCG logo are registered trademarks of Genetics Computer Group, Inc.
All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.